

Paul D. Miller aka DJ Spooky, Peder Anker, Professor at NYU, Mitchell Joachim, Principal Architect at Terreform One and NYU Professor
Algal Isopraxis (song) – a genetic portrait of algae in the key of C. DNA Sequence mapped by Sebastian Cocioba, NY Botanics
DNA: atgttcaggatgttcctactctggagctttaattgcacgatcaacttccgcatgtttttgctgtggtcgttcaattgcaccattaacttccgtatgtttctgctatggagcttcaactgtacaataaacttcagaatgttccttctctggtccttcaattgtactattaactttcgaatgtttctattatggtctttcaactgtacgattaacttttgcatgttcctgttgtggagtttcaactgtactatcaactttcgaatgttcctcttgtggtcattcaactgcactataaacttccgaatgtttctcctctggtcgtttaattgtacgataaactttagaatgttcctgctgtggagttttaactgcaccatcaatttcaggatgttcctgttgtggcgatttaattgcacaatcaactttcgaatgttccttttatggtcattcaactgtacgattaattttcgcatgttcttgctctggagttttaactgtaccataaacggccaccatcaccatcaccattgatgataa
Amino Acid: MFRMFLLWSFNCTINFRMFLLWSFNCTINFRMFLLWSFNCTINFRMFLLWSFNCTINFRMFLLWSFNCTINFCMFLLWSFNCTINFRMFLLWSFNCTINFRMFLLWSFNCTINFRMFLLWSFNCTINFRMFLLWRFNCTINFRMFLLWSFNCTINFRMFLLWSFNCTINGHHHHHH***
Ocean Song:
A composition by Paul D. Miller aka DJ Spooky
Earth Ocean
Every forest is a symphony. Polyphony. Polyrhythm. Ultra dense canopies of sound. The acoustic call and response of every species in the ecosystem creates a complex acoustic architecture that fosters a dense and hyper layered phenomena that follows the totality of the way we think of any forest. The complex sound systems that animate forests are an incredibly rich tapestry. But what happens when we look at the way sound and plants act underwater? What happens when we look at the interplay of biophonic architecture as a kind of pattern recognition based on acoustic phenomena?
One of the most important parts of the global underwater architecture of plants is kelp, a kind of macroalgae. Kelp forests cover a third of the world’s coastlines, and are a powerful component of the oceans’ ecosystems.
Kelp forests are often called “rainforests of the ocean” because they are a reflection of complex underwater ecosystems that provide food and shelter for many species. Kelp are large brown seaweeds (phaeophyta), in over 30 different genera that live in dense clusters in the cool waters close to the shore. Amazingly enough, kelp forests are one of the most widely distributed marine primary producers that remove and sequester some amount of CO2 from the atmosphere. The amount will vary from place to place and over time, but the basic idea is that they are a super important part of the global ecosystem. According to several studies, kelp forests provide around $500 billion in value to global commerce and capture, at a minimum, over 4.5 million tons of carbon dioxide from seawater each year. Most of kelp’s economic benefits come from creating habitat for fish and by sequestering nitrogen and phosphorus – the amount of greenhouse gases sequestered depends on which location and which species of kelp we are looking at, but the general idea is that they are a critical component of the way we think of some of the largest phenomena on Earth – the oceans and their relationship to the carbon and oxygen cycle that animates the planet.
The history of Western music has a couple of major compositions that focus on water: Handel’s “Water Music,” John Luther Adams “Become Ocean,” David Tudor’s “Rainforest,” Ravel’s “Jeux d’eau,” John Cage’s “Water Music,” Debussy’s “Le Mer” … the list goes on. The basic idea is that composers have engaged the concept of water songs to celebrate the fact that water is the core of life and it’s relationship to the core aspects of what makes Nature so powerful. On the other hand, kelp is a bit more under the radar. How many of us can name songs after one of the most important plant species of the ocean?
Biophilic versus Biophonic
Kelp can look like “trees that grow underwater” but this is deceptive – they lack tissues to carry water and food throughout their systems. Before we move further into the discussion – let’s clarify terms. Seaweed, kelp, algae, plankton, phytoplankton, zooplankton, cyanobacteria… these terms are all based on what one could argue is the forerunner of all plant life on Earth.
What scientists call “biophony” is the sound of the biosphere as humans have interpreted it. In this situation, sound is an artifact of deep time. Think of the genome of algae and kelp as a dataset, and a component of computational biology. Plants colonized the land as they moved from the oceans to dominate the terrestrial environment around 500 million years ago during what scientists call the Ordovician period. We live in the deep time accumulated, nonlinear world of the law of unintended consequences and genetic selective adaptation, and every plant around you shows the etching of deep time in a mega cycle of evolution. The evolutionary impact of this transition of the movement of plants onto land was a significant step in Earth’s history, as it eventually allowed for the development of terrestrial ecosystems and the emergence of land animals. Every garden, every farm, every forest and meadow – they all owe their existence to this migration in deep time. The case for the composition I am making is based on how music is an abstract machine composed of many moving parts.
Kelp and algae are basic direct descendants of the first plants to colonize the atmosphere and bring about an oxygen based planet.
The idea for this would be a composition based on translating the material into a series of compositions looking at the genome of plants – focused on algae, spirulina, chlorella as genetic material that predates land based plants. The basic idea would be a data sonification of the genome of algae and its generative models
Examples:
Making music out of DNA
MOMA – David Tudor – Rain Forest
Credits: Terreform ONE
Mitchell Joachim, Peder Anker, Melanie Fessel, Paul D. Miller, aka DJ Spooky.
Studio: Vivian Kuan (Executive Director), Julie Bleha.
Science: Oliver Medvedik, Sebastian Cocioba.
Design: David Paraschiv, Emily Young, Sky Achitoff, Avantika Velho, JJ Zhijie Jin.
Collaborators: Wendy W. Fok, WE-DESIGNS.
Media: Michelle Alves De Lima.
Research: Nicholas Lynch, Marina Ongaro, Ava Hudson. Jerzelle Lim, Helen Gui.
Structural Engineer: Robert Silman Associates Structural Engineers.
Botanical Advisors: LandShifterZ, Ezekiel Golan.
Sponsors: U.S. National Endowment for the Arts, New York University, NYU Global Research Initiatives in the Office of the Provost, Oslo School of Architecture and Design, RheinMain University of Applied Sciences.
Special Thanks:
Carlo Ratti, Curator of the 19th International Architecture Exhibition. Victoria Rosner, Dean of Gallatin School of Individualized Study at New York University.